Friday, April 24, 2015

gauleiter pliny nolan



"We need to pay exquisite attention to our responses to things -- noticing what makes our flame glow brighter. If we pay attention to those things, we'll be able to catch the flame and feed it." (Nina Simons)


Panoramic ccccccaaaaaaaaatttttt


Dig notice I was missing?  Seems TY was messing with internet settings and knocked out any chance I had to even read messages unless I was out of the house.  He somehow changed passwords to something I have no idea of and didn't have time to sort it out with Comcast.  ANDou can't change a password unless you can get on the internet-  so my genius guy found outI'm back from Boston where I met some glaring sunshine-  so bright I had to wear my sunglasses inside!  A fortunate weather trip?  Not necessarily, it's mostly due to having a couple of GUYS there washing my windows!  We are putting the condo on the market and are cleaning it out, cleaning it up, and getting a few things done that it's hard to schedule not living here.  Needless to say...

Every muscle in my body was aching from packing up stuff for storage and eventually shipping off.  I've pulled out all the drawers and unbelievably found SIX bottles of heavy narcotics prescribed from operations more than 10 years ago-  I hate taking that stuff so would stick it int he way-back and didn't realize I still had any.  No, don't break in looking for my stash, I sprayed it liberally with 409 and a little water, came back in an hour ant had turned into marshmallow fluff and was easily disposable in the trash.  Sorry, already gone.  I coulda been rich.

I packed 14 boxes so far, mostly just pictures in frames, books and CDs (TY won't part with them, doesn't trust iPod technology, says 'it doesn't sound the same'.  Also doesn't like the way iTunes lists different acts of an opera-  it may be out of sequence.  Geesh.  I've pulled all the dishes out of the cupboards I want to send, some favorite hand made pottery and the antique stuff I love.  but I am out of bubble wrap and we were car sharing so much will have to wait.  To screw up our getting around to accomplish things, this was also Boston Marathon weekend, formerly Marathon Day but like so many other really cool things, blown out of the water by folks trying to make a buck.

But I'm home again and finally have internet service back so catch-up is the name of the game and unfortunately the Muse is the one knocked to the end of the list.  

Today we have a theme (I love themes) for some art I found- 
 'things made with things not meant to make them'




A whole series of Lego clutch purses!  I.....want....one....







Plants and animals made from PET bottles!  Czech artist Veronika Richterov√°, born in 1964, the year represented a turning point in her artistic foray when she devoted herself to creating individualistic art pieces with the easily accessible PET bottles.  In Veronika’s hands, the easily malleable PET bottles has proven to be an excellent material for fulfilling her artistic intentions. She has been breathing new life into these recycled items for the past decade, adopting various methods of cutting, heating and assemblage to produce quirky products, from crocodiles to sofas, light fixtures to plants.

I'll be back soon as I can.  I am racing over to the house this morning to get paint swatches sorted out-  the ceilings are done and now I have to pick colors for the coffered parts and the walls.  The red laundry looked good, but I'm changing the living room from white to something a bit softer...and Agreeable!  (It's called Agreeable Gray!)  Also today we are picking up my niece at the airport as she is understandably taking a break this weekend from college dining.  It will be fun to have her around!

Hope she likes squirrels.



No comments :